ToolVet
82trust / 100

Crispr Offtarget

by bio.halowerk.com in Search & web

x402 APIPassing, checked 6 min ago

Compares one guide with caller-supplied candidate protospacers, weights mismatches in the guide’s final ten positions twice, applies a simple NGG PAM penalty, and ranks a transparent similarity score. It does not search a genome, model bulges, chromatin or nuclease-specific biology, and must not be used as a clinical or laboratory safety decision.

POST https://bio.halowerk.com/v1/crispr-offtarget

Last 30 days

All checks passedSome failedAll failedNot checked
Uptime
100%
Response time
107 ms typical, 107 ms slowest 5%
Last check
6 min ago
Next check
in 26 min

How to call it

# See the payment challenge (nothing is charged)
curl -i -X POST "https://bio.halowerk.com/v1/crispr-offtarget" \
  -H "content-type: application/json" \
  -d '{"candidates":[{"id":"candidate-1","pam":"AGG","protospacer":"GAGTCCGAGCAGAAGAAGAA"},{"id":"candidate-2","pam":"TGG","protospacer":"GAGTCCGAGCAGAAGATGAA"},{"id":"candidate-3","pam":"TGA","protospacer":"GACTCCGAGCAGAAGAAGAT"}],"guide":"GAGTCCGAGCAGAAGAAGAA"}'
import { wrapFetchWithPayment } from "@x402/fetch";
import { x402Client } from "@x402/core/client";
import { ExactEvmScheme } from "@x402/evm/exact/client";
import { privateKeyToAccount } from "viem/accounts";

const client = new x402Client().register(
  "eip155:8453",
  new ExactEvmScheme(privateKeyToAccount(process.env.AGENT_KEY)),
);
const pay = wrapFetchWithPayment(fetch, client);

// Not sure it's safe to pay? Preflight it first for $0.005:
// GET https://toolvet.app/api/v1/check?url=https%3A%2F%2Fbio.halowerk.com%2Fv1%2Fcrispr-offtarget
const res = await pay("https://bio.halowerk.com/v1/crispr-offtarget", {
  method: "POST",
  headers: { "content-type": "application/json" },
  body: JSON.stringify({"candidates":[{"id":"candidate-1","pam":"AGG","protospacer":"GAGTCCGAGCAGAAGAAGAA"},{"id":"candidate-2","pam":"TGG","protospacer":"GAGTCCGAGCAGAAGATGAA"},{"id":"candidate-3","pam":"TGA","protospacer":"GACTCCGAGCAGAAGAAGAT"}],"guide":"GAGTCCGAGCAGAAGAAGAA"}),
});
console.log(await res.json());

Example input

{
  "candidates": [
    {
      "id": "candidate-1",
      "pam": "AGG",
      "protospacer": "GAGTCCGAGCAGAAGAAGAA"
    },
    {
      "id": "candidate-2",
      "pam": "TGG",
      "protospacer": "GAGTCCGAGCAGAAGATGAA"
    },
    {
      "id": "candidate-3",
      "pam": "TGA",
      "protospacer": "GACTCCGAGCAGAAGAAGAT"
    }
  ],
  "guide": "GAGTCCGAGCAGAAGAAGAA"
}

Security scan

  • No findings. We scan names, descriptions and tool definitions for hidden instructions and other prompt-injection patterns.

Recent checks

WhenResultHTTPTimePrice
6 min agoPassed402107 ms$0.004
5 h agoPassed402203 ms$0.004