ToolVet
80trust / 100

Phage Matching

by bio.halowerk.com in Other

x402 APIPassing, checked 58 min ago

Slides each caller-supplied spacer over a bounded phage sequence in both orientations, records its minimum Hamming distance and reports matches within a caller-selected mismatch threshold. It does not account for PAMs, phage taxonomy, infection biology, escape, host range or therapeutic suitability.

POST
https://bio.halowerk.com/v1/phage-matching
Price
$0.004
per call in USDC
Uptime
100%
last 30 days
Response time
117 ms
180 ms slowest 5%
Last check
Passed
58 min ago, next any minute now

Run a free test callHow to call it

Reliability

All checks passedSome failedAll failedNot checked

Status and outage history · Atom feed · Watch with other listings

How to call it

POST https://bio.halowerk.com/v1/phage-matching

Each call costs $0.004 in USDC on Base, paid with the request over x402.

Run a free test callOne unpaid request, the way an agent sends it. You see the payment challenge it gets back. Nothing is charged.

Example request

From the listing.

POST https://bio.halowerk.com/v1/phage-matching
content-type: application/json

{
  "max_mismatches": 2,
  "phage_sequence": "AACCGTTAGGCTAACCGTTCGATCGGATCCGAATTCGGCATGCA",
  "spacers": [
    {
      "id": "spacer-1",
      "sequence": "GGCTAACCGTTCGATC"
    },
    {
      "id": "spacer-2",
      "sequence": "ATGCCTGAATTCGGCA"
    }
  ]
}

Parameters

ParameterTypeRequiredDescription
max_mismatchesintegerYes
phage_sequencestringYes
spacersarray of objectYes

Example response

The listing has no example response.

Call it from code

The curl command shows the payment challenge. The JavaScript and Python versions pay and call, and never pay more than $0.004.

curl: see the payment challenge
# bash or zsh: see the payment challenge. Nothing is charged.
curl -sS -g -i -X POST 'https://bio.halowerk.com/v1/phage-matching' \
  -H 'content-type: application/json' \
  --data-raw '{"max_mismatches":2,"phage_sequence":"AACCGTTAGGCTAACCGTTCGATCGGATCCGAATTCGGCATGCA","spacers":[{"id":"spacer-1","sequence":"GGCTAACCGTTCGATC"},{"id":"spacer-2","sequence":"ATGCCTGAATTCGGCA"}]}'

# x402 v2 sends the challenge base64-encoded in the PAYMENT-REQUIRED header (v1 sends it in the body).
# To read the header:
curl -sS -g -o /dev/null -D - -X POST 'https://bio.halowerk.com/v1/phage-matching' \
  -H 'content-type: application/json' \
  --data-raw '{"max_mismatches":2,"phage_sequence":"AACCGTTAGGCTAACCGTTCGATCGGATCCGAATTCGGCATGCA","spacers":[{"id":"spacer-1","sequence":"GGCTAACCGTTCGATC"},{"id":"spacer-2","sequence":"ATGCCTGAATTCGGCA"}]}' \
  | grep -i '^payment-required:' | cut -d' ' -f2 | tr -d '\r' | base64 --decode
JavaScript: pay and call
// npm i @x402/fetch @x402/evm viem
import { wrapFetchWithPayment, x402Client } from "@x402/fetch";
import { registerExactEvmScheme } from "@x402/evm/exact/client";
import { privateKeyToAccount } from "viem/accounts";

// Pays at most $0.004 per call.
const client = new x402Client().setSpendControls({ maxAmountPerPayment: "$0.004" });
registerExactEvmScheme(client, { signer: privateKeyToAccount(process.env.EVM_PRIVATE_KEY) });
const pay = wrapFetchWithPayment(fetch, client);

// Not sure it's safe to pay? ToolVet checks it first for $0.005. Pay for that from a separate
// client: this one is capped at $0.004 per payment. GET https://toolvet.app/api/v1/check?url=https%3A%2F%2Fbio.halowerk.com%2Fv1%2Fphage-matching&method=POST
const res = await pay("https://bio.halowerk.com/v1/phage-matching", {
  method: "POST",
  headers: { "content-type": "application/json" },
  body: JSON.stringify({
    "max_mismatches": 2,
    "phage_sequence": "AACCGTTAGGCTAACCGTTCGATCGGATCCGAATTCGGCATGCA",
    "spacers": [
      {
        "id": "spacer-1",
        "sequence": "GGCTAACCGTTCGATC"
      },
      {
        "id": "spacer-2",
        "sequence": "ATGCCTGAATTCGGCA"
      }
    ]
  }),
});
console.log(res.status, await res.text());
Python: pay and call
# pip install "x402[requests,evm]"
import os
from eth_account import Account
from x402 import x402ClientSync
from x402.http.clients import x402_requests
from x402.mechanisms.evm import EthAccountSigner
from x402.mechanisms.evm.exact.register import register_exact_evm_client

# Pays at most $0.004 per call.
client = x402ClientSync().set_spend_controls({"max_amount_per_payment": "$0.004"})
register_exact_evm_client(client, EthAccountSigner(Account.from_key(os.environ["EVM_PRIVATE_KEY"])))

with x402_requests(client) as session:
    res = session.post(
        "https://bio.halowerk.com/v1/phage-matching",
        json={
            "max_mismatches": 2,
            "phage_sequence": "AACCGTTAGGCTAACCGTTCGATCGGATCCGAATTCGGCATGCA",
            "spacers": [
                {
                    "id": "spacer-1",
                    "sequence": "GGCTAACCGTTCGATC",
                },
                {
                    "id": "spacer-2",
                    "sequence": "ATGCCTGAATTCGGCA",
                },
            ],
        },
    )
    print(res.status_code, res.text)

Security scan

No findings

We scan names, descriptions and tool definitions for hidden instructions and other prompt-injection patterns.

Recent checks

WhenResultHTTPTimePrice
58 min agoPassed402129 ms$0.004
4 h agoPassed402140 ms$0.004
7 h agoPassed402108 ms$0.004
10 h agoPassed402122 ms$0.004
15 h agoPassed402159 ms$0.004
Show 10 older checks
21 h agoPassed402108 ms$0.004
26 h agoPassed402146 ms$0.004
31 h agoPassed402117 ms$0.004
36 h agoPassed402104 ms$0.004
41 h agoPassed402101 ms$0.004
46 h agoPassed402106 ms$0.004
2 days agoPassed402112 ms$0.004
2 days agoPassed402106 ms$0.004
3 days agoPassed402114 ms$0.004
3 days agoPassed402131 ms$0.004